v vulnificus atcc 27562 strain Search Results


v vulnificus atcc 27562 t  (ATCC)
97
ATCC v vulnificus atcc 27562 t
V Vulnificus Atcc 27562 T, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/v vulnificus atcc 27562 t/product/ATCC
Average 97 stars, based on 1 article reviews
v vulnificus atcc 27562 t - by Bioz Stars, 2026-02
97/100 stars
  Buy from Supplier
malb k 12 λs neb v vulnificus strains atcc 27562 wild type  (New England Biolabs)
86
New England Biolabs malb k 12 λs neb v vulnificus strains atcc 27562 wild type
Malb K 12 λs Neb V Vulnificus Strains Atcc 27562 Wild Type, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/malb k 12 λs neb v vulnificus strains atcc 27562 wild type/product/New England Biolabs
Average 86 stars, based on 1 article reviews
malb k 12 λs neb v vulnificus strains atcc 27562 wild type - by Bioz Stars, 2026-02
86/100 stars
  Buy from Supplier
reference strains  (ATCC)
98
ATCC reference strains
Reference Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reference strains/product/ATCC
Average 98 stars, based on 1 article reviews
reference strains - by Bioz Stars, 2026-02
98/100 stars
  Buy from Supplier
tctggtgcaggtcactacgtcgcagtaacttacaagtgttaa v vulnificus atcc 27562 v parahaemolyticus atcc 17802 ompk spovec r start  (ATCC)
99
ATCC tctggtgcaggtcactacgtcgcagtaacttacaagtgttaa v vulnificus atcc 27562 v parahaemolyticus atcc 17802 ompk spovec r start
Tctggtgcaggtcactacgtcgcagtaacttacaagtgttaa V Vulnificus Atcc 27562 V Parahaemolyticus Atcc 17802 Ompk Spovec R Start, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tctggtgcaggtcactacgtcgcagtaacttacaagtgttaa v vulnificus atcc 27562 v parahaemolyticus atcc 17802 ompk spovec r start/product/ATCC
Average 99 stars, based on 1 article reviews
tctggtgcaggtcactacgtcgcagtaacttacaagtgttaa v vulnificus atcc 27562 v parahaemolyticus atcc 17802 ompk spovec r start - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier
vibrio vulnificus  (ATCC)
97
ATCC vibrio vulnificus
Vibrio Vulnificus, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vibrio vulnificus/product/ATCC
Average 97 stars, based on 1 article reviews
vibrio vulnificus - by Bioz Stars, 2026-02
97/100 stars
  Buy from Supplier
vibrio species reference strains  (ATCC)
95
ATCC vibrio species reference strains
Vibrio Species Reference Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vibrio species reference strains/product/ATCC
Average 95 stars, based on 1 article reviews
vibrio species reference strains - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier
v vulnificus atcc 27562 pqe60  (ATCC)
94
ATCC v vulnificus atcc 27562 pqe60
MIC values for the different Vibrio <t> vulnificus ATCC 27562 </t> strains
V Vulnificus Atcc 27562 Pqe60, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/v vulnificus atcc 27562 pqe60/product/ATCC
Average 94 stars, based on 1 article reviews
v vulnificus atcc 27562 pqe60 - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier
controls  (ATCC)
94
ATCC controls
MIC values for the different Vibrio <t> vulnificus ATCC 27562 </t> strains
Controls, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/controls/product/ATCC
Average 94 stars, based on 1 article reviews
controls - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier
pathogenic bacterial strains  (ATCC)
99
ATCC pathogenic bacterial strains
MIC values for the different Vibrio <t> vulnificus ATCC 27562 </t> strains
Pathogenic Bacterial Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pathogenic bacterial strains/product/ATCC
Average 99 stars, based on 1 article reviews
pathogenic bacterial strains - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier
v parahaemolyticus atcc 17802 v vulnificus atcc 27562 v mytili atcc 51288 qnr reca qnr reca qnr reca cold shock  (ATCC)
90
ATCC v parahaemolyticus atcc 17802 v vulnificus atcc 27562 v mytili atcc 51288 qnr reca qnr reca qnr reca cold shock
Environmental stresses and expression of qnr in Vibrio species
V Parahaemolyticus Atcc 17802 V Vulnificus Atcc 27562 V Mytili Atcc 51288 Qnr Reca Qnr Reca Qnr Reca Cold Shock, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/v parahaemolyticus atcc 17802 v vulnificus atcc 27562 v mytili atcc 51288 qnr reca qnr reca qnr reca cold shock/product/ATCC
Average 90 stars, based on 1 article reviews
v parahaemolyticus atcc 17802 v vulnificus atcc 27562 v mytili atcc 51288 qnr reca qnr reca qnr reca cold shock - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


MIC values for the different Vibrio vulnificus ATCC 27562 strains

Journal: Antimicrobial Agents and Chemotherapy

Article Title: Analyzing Possible Native Functions of the Quinolone Resistance Gene qnr in Vibrio vulnificus

doi: 10.1128/AAC.00232-21

Figure Lengend Snippet: MIC values for the different Vibrio vulnificus ATCC 27562 strains

Article Snippet: V. vulnificus ATCC 27562/pQE60 , 0.063 , 0.063 , 1 , 1 , 0.125 , 2 , >512 , 0.63/0.25 , 1.

Techniques:

Environmental stresses and expression of qnr in Vibrio species

Journal: Antimicrobial Agents and Chemotherapy

Article Title: Cold Shock Induces Chromosomal qnr in Vibrio Species and Plasmid-Mediated qnrS1 in Escherichia coli

doi: 10.1128/AAC.01472-19

Figure Lengend Snippet: Environmental stresses and expression of qnr in Vibrio species

Article Snippet: The results suggest that chromosomal qnr in Vibrio species is a cold shock gene and that induction of expression of qnr by cold shock is not a specific feature confined to chromosomal qnrA but can also be generalized to chromosomal qnrS homologs. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Condition Mean (SD) fold change in gene expression a V. parahaemolyticus ATCC 17802 V. vulnificus ATCC 27562 V. mytili ATCC 51288 qnr recA qnr recA qnr recA Cold shock (10°C) 2.25 b (0.55) 2.25 (0.28) 2.54 c (0.57) 2.53 (0.34) 1.95 d (0.29) 2.40 (0.33) Heat shock (42°C) 1.36 e (0.25) 0.67 (0.10) 1.39 f (0.26) 1.34 (0.56) 1.66 g (0.50) 1.04 (0.57) Hyperosmolality (5% NaCl) 1.16 (0.42) 3.06 (0.42) 1.43 (0.33) 1.65 (0.32) 0.77 (0.20) 1.49 (0.38) Hypo-osmolality (1% NaCl) 0.99 (0.17) 1.05 (0.16) 1.29 (0.36) 1.01 (0.15) 0.83 (0.06) 1.20 (0.10) Acid stress (pH 6.0) 0.80 (0.17) 0.90 (0.20) 1.25 (0.08) 1.58 (0.10) 1.26 (1.30) 0.48 (0.32) Base stress (pH 8.0) 1.04 (0.08) 1.71 (0.41) 1.28 (0.10) 1.29 (0.14) 1.42 (0.08) 1.28 (0.24) Oxidative stress 1.20 (0.92) 2.01 (0.20) 0.87 (0.27) 2.14 (0.62) 1.18 (0.10) 2.48 (0.08) Nutrient limitation 0.84 (0.08) 0.68 (0.13) 1.17 (0.12) 0.88 (0.04) 1.18 (0.08) 1.02 (0.04) Open in a separate window a Each value was obtained from three independent samples. b P = 0.017. c P = 0.008. d P = 0.005. e P = 0.066. f P = 0.051. g P = 0.086.

Techniques: Expressing, Gene Expression